|
ATCC
paper n a hek293t atcc crl 3216 oligonucleotides primers Paper N A Hek293t Atcc Crl 3216 Oligonucleotides Primers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/293T/pm41916275-697-22-25 Average 99 stars, based on 1 article reviews
paper n a hek293t atcc crl 3216 oligonucleotides primers - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
OriGene
paper n a qpcr primer tnfa fw Paper N A Qpcr Primer Tnfa Fw, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/TNF+alpha+(TNF)+Human+qPCR+Primer+Pair/pm41863795-623-153-185 Average 94 stars, based on 1 article reviews
paper n a qpcr primer tnfa fw - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
OriGene
paper n a qpcr primer il1b fw Paper N A Qpcr Primer Il1b Fw, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/Primer/pm41863795-623-164-185 Average 97 stars, based on 1 article reviews
paper n a qpcr primer il1b fw - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc Paper N A Kras G12d Conditional Pcr Primer 1 Gtctttccccagcacagtgc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/g12d+kras+lsl/pm40712568-356-209-218 Average 86 stars, based on 1 article reviews
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
paper n a cloning primers Paper N A Cloning Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/SUCROSE+CRYSTAL+CERT+ACS+12KG/pmc12240685__mmc5-659-59-85 Average 99 stars, based on 1 article reviews
paper n a cloning primers - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
10X Genomics
paper n a real time qpcr primers Paper N A Real Time Qpcr Primers, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/molecule+pacbio+real+sequencing+single+time/pm40398420-310-14-39 Average 86 stars, based on 1 article reviews
paper n a real time qpcr primers - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
OriGene
paper n a primer Paper N A Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/Primer/pm40359940-212-94-102 Average 97 stars, based on 1 article reviews
paper n a primer - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Tree Star Inc
paper n a chip qpcr primers Paper N A Chip Qpcr Primers, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/a+chip+n+paper+primers+qpcr/pm40107273-369-52-76 Average 86 stars, based on 1 article reviews
paper n a chip qpcr primers - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
paper n a random hexamer primer thermo fisher cat Paper N A Random Hexamer Primer Thermo Fisher Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+primer/pm39207904-202-183-188 Average 86 stars, based on 1 article reviews
paper n a random hexamer primer thermo fisher cat - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |